Codon Usage

Codon Usage accepts a DNA sequence and returns the number and frequency of each codon type. Since the program also compares the frequencies of codons that code for the same amino acid (synonymous codons), you can use it to assess whether a sequence shows a preference for particular synonymous codons.

Paste the raw or FASTA sequence into the text area below. >sample sequence atgtttcagaaagaggatcttgctacatggatgcaaatttcaatgagtggtcaatttgatgatacagcattagaggaatggagtacaaatggtaaagaacctgagatctgtgagaaatctccaaaagctgatggagttactacgattatggagagagctctatgtccatgggatagcagagtcaactaccaagagagccgagaacctaaattgattgctgaatcagtttgtctatgccgtaagagccgtggttctacaggagctttctgtatgccaattgttcgaaaagttccaattctccgacgtgtctcttgtgatcgttcaacaggtttatggaattatgtaagatcaactgagctaataactgttggatgtcattctgtattgccaagaactcaaagagcagcacgtcttgcccatttatcatcttctcgtattattgtttaa

Enter the codon table you wish to use for the genetic code (in GCG format). The default codon table specifies the standard genetic code. AmAcid Codon Number /1000 Fraction .. Gly GGG 50527.00 11.12 0.15 Gly GGA 39036.00 8.59 0.12 Gly GGT 114185.00 25.14 0.34 Gly GGC 130043.00 28.63 0.39 Glu GAG 83804.00 18.45 0.32 Glu GAA 179460.00 39.51 0.68 Asp GAT 146794.00 32.32 0.63 Asp GAC 87759.00 19.32 0.37 Val GTG 115687.00 25.47 0.36 Val GTA 51020.00 11.23 0.16 Val GTT 86572.00 19.06 0.27 Val GTC 67356.00 14.83 0.21 Ala GCG 146264.00 32.20 0.34 Ala GCA 93390.00 20.56 0.22 Ala GCT 73677.00 16.22 0.17 Ala GCC 113412.00 24.97 0.27 Arg AGG 7423.00 1.63 0.03 Arg AGA 12345.00 2.72 0.05 Ser AGT 41544.00 9.15 0.15 Ser AGC 70867.00 15.60 0.26 Lys AAG 51685.00 11.38 0.25 Lys AAA 156169.00 34.38 0.75 Asn AAT 84846.00 18.68 0.46 Asn AAC 98018.00 21.58 0.54 Met ATG 123604.00 27.21 1.00 Ile ATA 24233.00 5.34 0.09 Ile ATT 135873.00 29.92 0.50 Ile ATC 111878.00 24.63 0.41 Thr ACG 63696.00 14.02 0.26 Thr ACA 35995.00 7.93 0.15 Thr ACT 43256.00 9.52 0.18 Thr ACC 103121.00 22.70 0.42 Trp TGG 65630.00 14.45 1.00 End TGA 4428.00 0.97 0.30 Cys TGT 23461.00 5.17 0.45 Cys TGC 28747.00 6.33 0.55 End TAG 1172.00 0.26 0.08 End TAA 9006.00 1.98 0.62 Tyr TAT 75774.00 16.68 0.58 Tyr TAC 55847.00 12.30 0.42 Leu TTG 60322.00 13.28 0.13 Leu TTA 62823.00 13.83 0.13 Phe TTT 100128.00 22.05 0.57 Phe TTC 74885.00 16.49 0.43 Ser TCG 39546.00 8.71 0.15 Ser TCA 35837.00 7.89 0.13 Ser TCT 42367.00 9.33 0.16 Ser TCC 40365.00 8.89 0.15 Arg CGG 25751.00 5.67 0.10 Arg CGA 16607.00 3.66 0.07 Arg CGT 93997.00 20.70 0.37 Arg CGC 96053.00 21.15 0.38 Gln CAG 130898.00 28.82 0.66 Gln CAA 67129.00 14.78 0.34 His CAT 57585.00 12.68 0.57 His CAC 43743.00 9.63 0.43 Leu CTG 231373.00 50.94 0.49 Leu CTA 18067.00 3.98 0.04 Leu CTT 51442.00 11.33 0.11 Leu CTC 48147.00 10.60 0.10 Pro CCG 101467.00 22.34 0.51 Pro CCA 38663.00 8.51 0.20 Pro CCT 32678.00 7.19 0.17 Pro CCC 24383.00 5.37 0.12